Skip to main content
100%

Gist ffcc056cd10b4ea1386f2a81189aa95a

✓ Published0🌍 Public
WWanagram
Last edited Mar 29, 2016
Created on Mar 29, 2016

This example shows the reverse complement of a DNA sequence, converting each nucleotide to its complementary base and reversing the order. The code defines a hardcoded string of genetic letters and processes it character by character using a `for` loop and a `switch` statement. It outputs the transformed sequence to the console with `console.log`, producing a string like “GGCTAGCTACGCCGCGACTAGCTACATGCGCGCTCAGCATCATCGCCGCGCAGGTTTGC.” No external libraries are used; the entire visualization is a plain JavaScript computation and text output.

AI-generated description

Similar vizzes

Loading thumbnail…

Gist f0d047bd1b55bcd4f98416acd33ce078

This example visualizes a DNA sequence by translating each codon into its corresponding amino acid and displaying the resulting protein sequence. The code stores the nucleotide string in an array of three-base codons, then uses a switch statement to map each codon to its amino acid abbreviation, including ambiguous codes like Asx and Glx. The visualization relies on standard JavaScript array methods and string manipulation rather than external libraries, processing the sequence data directly in the browser to reveal the encoded amino acid chain.

WWanagram
73% match
Loading thumbnail…

Gist 3b2b529e54d1f10d3698fcf6b22ee1e4

This example shows the nucleotide composition of a DNA sequence by calculating the percentage of adenine, thymine, cytosine, and guanine. It uses a JavaScript loop with a switch statement to count each base in the hardcoded `sequence` string, then logs the percentages to the console. No external libraries or visualization APIs are used; the rendering approach is purely text-based output via `console.log`. The data source is the static sequence embedded in the code.

WWanagram
67% match
Loading thumbnail…

Gist 0b2fc1de581870e9c573c5a203d3b293

This example demonstrates global sequence alignment using the Needleman-Wunsch algorithm, comparing two nucleotide strings ("ATGCGAATCGC" and "ATCCTACCG"). It shows the dynamic programming score matrix via `console.table`, then performs a traceback to reconstruct the optimal alignment, printing both aligned sequences with gaps denoted by underscores. The visualization relies on plain JavaScript arrays and recursive functions, with no external libraries, rendering results purely through console output.

WWanagram
63% match
Loading thumbnail…

Gist 9a5e7b204b7bb4e90cc3f9b7bf5b7dad

This example shows a recursive JavaScript function that reverses a string. The function `rec` takes a word, checks if its length is zero, and returns an empty string as the base case; otherwise, it appends the last character to the result of calling `rec` on the string with that last character removed. It demonstrates the reversal of the input "hello" to "olleh" through a simple recursion pattern. The code uses plain JavaScript with no external libraries or rendering APIs.

MMistyBlunch
63% match
Loading thumbnail…

Genetic.js Hello World

This example demonstrates a genetic algorithm evolving a string toward a target phrase, with each generation’s best individual displayed in a table. It uses Genetic.js for the evolutionary operations (selection, crossover, mutation) and d3.v4 to append rows to the table body. The fitness function scores characters by proximity to the target, and the table highlights per-character differences with background colors. The visualization shows the progression of generations, fitness values, and the evolving best solution in real time.

PPhilippe Rivière
58% match
Loading thumbnail…

Function to reverse an 8 bit number

This example visualizes the process of reversing an 8-bit number, showing the bitwise transformation from input to output. The code uses the `Number.Mod` and `Number.BitwiseAnd` JavaScript APIs to perform the reversal, applying the bitmask `0x010884422010` and multiplication factor `0x0202020202` as part of the algorithm. The visualization renders the data as a compact graphic, with each step of the reversal represented spatially, though the exact rendering method is not detailed in the source. The gist, authored by Hugoberry, provides a minimal, functional demonstration of the reversal logic in a single line.

HHugoberry
58% match
Loading thumbnail…

Gist 6ca203fa1eab16a0f3c98d442ba9eea0

This example demonstrates a JavaScript function that transforms an input string into a "mumbling" pattern, where each character is repeated incrementally, capitalized at the start, and joined by hyphens. The visualization shows the result of applying this logic to sample strings like "abcd," "cwAt," and "RqaEzty" using the built-in `split`, `toLowerCase`, `toUpperCase`, `slice`, `map`, and `join` methods, along with custom `capitalize` and `accum` functions. The code relies on plain JavaScript string array manipulation without external libraries, producing outputs such as "A-Bb-Ccc-Dddd" for the first example.

MMistyBlunch
58% match
Loading thumbnail…

Gist 846581

This example visualizes the inverse of Java’s string hash function, showing how a given integer hash code can be reversed into a string. It uses a custom C implementation, including `java_hash_code` and `java_unhash_code`, to compute and invert hashes, with the recursive `unhash2` function building the string character by character. The code also includes a known collision case, where the hash of “polygenelubricants” maps to `INT_MIN`. The visualization is static, relying on the C logic and standard libraries like `string.h` and `limits.h` rather than any rendering framework.

XXXX
57% match