Skip to main content
100%

Gist 846581

✓ Published0🌍 Public
XXXX
Last edited Feb 27, 2011
Created on Feb 27, 2011

This example visualizes the inverse of Java’s string hash function, showing how a given integer hash code can be reversed into a string. It uses a custom C implementation, including `java_hash_code` and `java_unhash_code`, to compute and invert hashes, with the recursive `unhash2` function building the string character by character. The code also includes a known collision case, where the hash of “polygenelubricants” maps to `INT_MIN`. The visualization is static, relying on the C logic and standard libraries like `string.h` and `limits.h` rather than any rendering framework.

AI-generated description

Similar vizzes

Loading thumbnail…

bad java code

This example visualizes a deliberate typo-laden Java program from a GitHub gist, highlighting syntax errors through a playful rendering. It displays the raw source code, including the misspelled method signature `main(Stringhhh[] args)` and the broken call `System.out.printggg`. The visualization uses text-based rendering from the gist's `gistfile1.txt`, presenting the code as a static, readable artifact. It does not execute or compile the Java, instead focusing on the textual representation of the flawed code for humorous or educational inspection.

KKyKyPy3
57% match
Loading thumbnail…

Gist ffcc056cd10b4ea1386f2a81189aa95a

This example shows the reverse complement of a DNA sequence, converting each nucleotide to its complementary base and reversing the order. The code defines a hardcoded string of genetic letters and processes it character by character using a `for` loop and a `switch` statement. It outputs the transformed sequence to the console with `console.log`, producing a string like “GGCTAGCTACGCCGCGACTAGCTACATGCGCGCTCAGCATCATCGCCGCGCAGGTTTGC.” No external libraries are used; the entire visualization is a plain JavaScript computation and text output.

WWanagram
57% match
Loading thumbnail…

Gist 1866a62d3cb6c066d421a78abd1324e2

This visualization monitors GitHub presence lists by displaying the last four characters of each contributor’s hash in the browser console. It uses a mouseover event listener on presence-list items to extract and log the hash suffix. The code relies on the standard Document Object Model (DOM) API with `querySelectorAll` and `addEventListener`, and does not employ external libraries. The data source is the live presence list rendered by GitHub’s interface, making the example a lightweight, dependency-free tool for observing participant hashes during collaborative sessions.

UUtopiah
56% match
Loading thumbnail…

Gist d740d28ab2549ada2394dbbe9728cd71

This visualization prints an alternating checkerboard pattern of spaces and hash symbols to the console, using standard JavaScript string concatenation and a nested `for` loop structure. The outer loop controls each row, while the inner loop builds the pattern by checking whether the row and column indices are even or odd. The code defines a fixed grid size of 8, generates each line into a string variable, and logs it with `console.log` before resetting the string for the next iteration. No external libraries are used; it relies solely on core JavaScript syntax and the console API.

MMistyBlunch
55% match
Loading thumbnail…

Function to reverse an 8 bit number

This example visualizes the process of reversing an 8-bit number, showing the bitwise transformation from input to output. The code uses the `Number.Mod` and `Number.BitwiseAnd` JavaScript APIs to perform the reversal, applying the bitmask `0x010884422010` and multiplication factor `0x0202020202` as part of the algorithm. The visualization renders the data as a compact graphic, with each step of the reversal represented spatially, though the exact rendering method is not detailed in the source. The gist, authored by Hugoberry, provides a minimal, functional demonstration of the reversal logic in a single line.

HHugoberry
55% match
Loading thumbnail…

Gist ec761bad0f5e7bfb19f46d45ba0b3355

This example defines a small JavaScript utility that converts hexadecimal color codes into their red, green, and blue component values. The code presents the `hexToRgb` function, which first parses the hex string—overlooking an optional leading `#`—into an integer, then extracts the separate color channels using bit shifts and bitwise AND operations. The function returns an array of three numbers, each representing the intensity of a channel. This demonstrates a modular approach to color handling, using only core JavaScript without any external libraries or APIs.

MMAKIO135
54% match
Loading thumbnail…

Gist 9a5e7b204b7bb4e90cc3f9b7bf5b7dad

This example shows a recursive JavaScript function that reverses a string. The function `rec` takes a word, checks if its length is zero, and returns an empty string as the base case; otherwise, it appends the last character to the result of calling `rec` on the string with that last character removed. It demonstrates the reversal of the input "hello" to "olleh" through a simple recursion pattern. The code uses plain JavaScript with no external libraries or rendering APIs.

MMistyBlunch
54% match
Loading thumbnail…

Function for reversing the bits in a 32bit number

The example demonstrates a custom function that reverses the order of bits in a 32-bit unsigned integer, a common low-level operation used in bit manipulation. It shows the step-by-step isolation and recombination of individual bytes (b0 through b3) before reversing the bits within each byte. The code relies on Power Query’s `Number.BitwiseAnd`, `Number.BitwiseShiftRight`, `Number.BitwiseShiftLeft`, and `Number.BitwiseOr` functions to mask, shift, and reassemble the bytes. A helper `reverse` function is implied for per-byte bit reversal, though not defined here. The visualization itself is a code snippet, not a graphical chart, highlighting the algorithmic logic rather than data representation.

HHugoberry
54% match