Skip to main content
100%

Gist 0b2fc1de581870e9c573c5a203d3b293

✓ Published0🌍 Public
WWanagram
Last edited Apr 29, 2016
Created on Apr 17, 2016

This example demonstrates global sequence alignment using the Needleman-Wunsch algorithm, comparing two nucleotide strings ("ATGCGAATCGC" and "ATCCTACCG"). It shows the dynamic programming score matrix via `console.table`, then performs a traceback to reconstruct the optimal alignment, printing both aligned sequences with gaps denoted by underscores. The visualization relies on plain JavaScript arrays and recursive functions, with no external libraries, rendering results purely through console output.

AI-generated description

Similar vizzes

Loading thumbnail…

Dynamic Programming

A dynamic programming matrix visualizes the alignment of two DNA sequences, "GAATTCAGTTA" and "GGATCGA", by filling a grid where each cell holds the optimal match score computed from neighboring cells. The code uses plain JavaScript arrays and nested loops to build the matrix, applying the recurrence relation with match penalties and gap scores. The final matrix is rendered as a console table via `console.table(arr)`, showing the scored path without any graphical library or SVG output.

WWanagram
76% match
Loading thumbnail…

fresh block

This example compares two DNA sequences by constructing a dynamic programming matrix that calculates the longest common subsequence score. It visualizes the alignment scoring process through a grid of numerical values, where each cell represents the optimal match score up to that position. The code builds a multi-dimensional array in plain JavaScript, iterating through both sequences to fill the matrix with scores based on match, insertion, or deletion logic. No external visualization libraries are used; the example focuses solely on the algorithmic computation within the HTML file.

WWanagram
71% match
Loading thumbnail…

Gist f0d047bd1b55bcd4f98416acd33ce078

This example visualizes a DNA sequence by translating each codon into its corresponding amino acid and displaying the resulting protein sequence. The code stores the nucleotide string in an array of three-base codons, then uses a switch statement to map each codon to its amino acid abbreviation, including ambiguous codes like Asx and Glx. The visualization relies on standard JavaScript array methods and string manipulation rather than external libraries, processing the sequence data directly in the browser to reveal the encoded amino acid chain.

WWanagram
68% match
Loading thumbnail…

Multiple Sequence Aligment

This visualization displays the results of a multiple DNA sequence alignment, showing 17 sequences as a grid of colored cells where each color represents one of four nucleotide bases (A, G, C, T) and gaps appear in white. It uses D3.js v3 to render the alignment as an SVG heatmap-like matrix, with each sequence labeled on the left and a legend showing the base-to-color mapping. The dataset comes from ClustalW2 alignment results, and interactive tooltips appear on hover, displaying the row, column, and base for any selected cell. The implementation binds data to SVG rectangles and uses D3’s enter/exit selections to create the grid.

JJverma
65% match
Loading thumbnail…

Gist 3b2b529e54d1f10d3698fcf6b22ee1e4

This example shows the nucleotide composition of a DNA sequence by calculating the percentage of adenine, thymine, cytosine, and guanine. It uses a JavaScript loop with a switch statement to count each base in the hardcoded `sequence` string, then logs the percentages to the console. No external libraries or visualization APIs are used; the rendering approach is purely text-based output via `console.log`. The data source is the static sequence embedded in the code.

WWanagram
64% match
Loading thumbnail…

Gist ffcc056cd10b4ea1386f2a81189aa95a

This example shows the reverse complement of a DNA sequence, converting each nucleotide to its complementary base and reversing the order. The code defines a hardcoded string of genetic letters and processes it character by character using a `for` loop and a `switch` statement. It outputs the transformed sequence to the console with `console.log`, producing a string like “GGCTAGCTACGCCGCGACTAGCTACATGCGCGCTCAGCATCATCGCCGCGCAGGTTTGC.” No external libraries are used; the entire visualization is a plain JavaScript computation and text output.

WWanagram
63% match
Loading thumbnail…

Gist d5a955d9a667be4ff4afe7064affbb31

This example demonstrates a bioinformatics mapping workflow for processing sequencing reads. The shell script uses the BWA alignment tool to map trimmed FASTQ files from multiple clones against a reference genome (NC_012967.fas). It first indexes the reference with `bwa index`, then iterates through a list of runs from `fastq/list_run`, performing alignment with `bwa aln` using four threads and converting the results to SAM format with `bwa samse` while adding read-group metadata via the `-r` flag. The script outputs aligned SAM files into the `mapping` directory.

NNpfn
60% match
Loading thumbnail…

Gist 143778d0c50388a317ebc30c0ec5de86

This Perl-based command-line tool calculates GC content and nucleotide percentages from a FASTA file. It reads the input file line by line, skipping headers, and tallies counts of G, C, A, T, and N bases. The output prints GC%, individual base percentages, and the N count, using basic string operations and conditional logic rather than external visualization libraries. The script demonstrates a simple text-based data summary workflow for bioinformatics sequence analysis.

NNpfn
58% match