Gist 3b2b529e54d1f10d3698fcf6b22ee1e4

100%

Gist 3b2b529e54d1f10d3698fcf6b22ee1e4

✓ Published0🌍 Public

Last edited Mar 29, 2016

Created on Mar 29, 2016

This example shows the nucleotide composition of a DNA sequence by calculating the percentage of adenine, thymine, cytosine, and guanine. It uses a JavaScript loop with a switch statement to count each base in the hardcoded `sequence` string, then logs the percentages to the console. No external libraries or visualization APIs are used; the rendering approach is purely text-based output via `console.log`. The data source is the static sequence embedded in the code.

AI-generated description

Similar vizzes

Loading thumbnail…

Gist f0d047bd1b55bcd4f98416acd33ce078

This example visualizes a DNA sequence by translating each codon into its corresponding amino acid and displaying the resulting protein sequence. The code stores the nucleotide string in an array of three-base codons, then uses a switch statement to map each codon to its amino acid abbreviation, including ambiguous codes like Asx and Glx. The visualization relies on standard JavaScript array methods and string manipulation rather than external libraries, processing the sequence data directly in the browser to reveal the encoded amino acid chain.

WWanagram

74% match

Loading thumbnail…

Counting nucleotides from a sequence

This example shows how to calculate the percentage of G and C nucleotides in a DNA sequence, a common metric in genomics. It first counts each nucleotide type (A, C, G, T) using a Python dictionary, then normalizes those counts by the total sequence length to compute percentages. The code defines two functions, `count_nucleotides_by_type` and `normalize_nucleotide_count`, and finally prints the combined G and C percentage for a hardcoded sequence string. No external visualization libraries are used; the output is a single text result.

RRobColeman

68% match

Loading thumbnail…

Gist ffcc056cd10b4ea1386f2a81189aa95a

This example shows the reverse complement of a DNA sequence, converting each nucleotide to its complementary base and reversing the order. The code defines a hardcoded string of genetic letters and processes it character by character using a `for` loop and a `switch` statement. It outputs the transformed sequence to the console with `console.log`, producing a string like “GGCTAGCTACGCCGCGACTAGCTACATGCGCGCTCAGCATCATCGCCGCGCAGGTTTGC.” No external libraries are used; the entire visualization is a plain JavaScript computation and text output.

WWanagram

67% match

Loading thumbnail…

Gist 143778d0c50388a317ebc30c0ec5de86

This Perl-based command-line tool calculates GC content and nucleotide percentages from a FASTA file. It reads the input file line by line, skipping headers, and tallies counts of G, C, A, T, and N bases. The output prints GC%, individual base percentages, and the N count, using basic string operations and conditional logic rather than external visualization libraries. The script demonstrates a simple text-based data summary workflow for bioinformatics sequence analysis.

NNpfn

65% match

Loading thumbnail…

Gist 0b2fc1de581870e9c573c5a203d3b293

This example demonstrates global sequence alignment using the Needleman-Wunsch algorithm, comparing two nucleotide strings ("ATGCGAATCGC" and "ATCCTACCG"). It shows the dynamic programming score matrix via `console.table`, then performs a traceback to reconstruct the optimal alignment, printing both aligned sequences with gaps denoted by underscores. The visualization relies on plain JavaScript arrays and recursive functions, with no external libraries, rendering results purely through console output.

WWanagram

64% match

Loading thumbnail…

sample problems for bioinformatics class

This example presents a set of JavaScript practice problems for a bioinformatics class, using D3.js v4 inside an HTML page. The code defines a `count_purine()` function that counts purine bases (A or G) in a DNA sequence string and logs the result to the browser’s developer console. No SVG graphics are rendered; instead, the page instructs students to debug and observe output in the console. The code includes commented-out stubs for additional functions, such as `percent_purine()` and `find_purine_rich()`, which are not yet implemented.

LLaurynKW

63% match

Loading thumbnail…

DNA sequence

This visualization animates a synthetic DNA double helix, where each colored node represents a letter from a string of fake genes and pulses along a twisting, sinusoidal path over time. It shows the helix rotating continuously, with lines connecting complementary strands and opacity varying based on depth to suggest a 3D structure rendered in SVG. The code fires a `setInterval` to regenerate and update data every 25 milliseconds, using d3’s `scaleLinear`, `extent`, `range`, and `interpolateRainbow` for color mapping. React manages the component, with fragments wrapping the DNA sequence inside the app’s root element.

MMauricio García Benítez

62% match

Loading thumbnail…

3D DNA HELIX From Sequence

This animated visualization renders a DNA helix from a user-supplied text sequence, showing two intertwined strands that rotate over time. Each nucleotide is represented as a colored circle, with colors mapped via `d3.interpolateRainbow` based on the unique characters in the string, while connecting lines between complementary bases emphasize the helical structure. The code uses D3.js v5 with SVG elements, updating positions and scales through a `setInterval` loop that regenerates data and applies logarithmic z-depth scaling to simulate three-dimensional perspective. The animation highlights the sequence’s layout by encoding torsional rotation and opacity changes.

MMauricio García Benítez

60% match