Caesars Cipher (ROT13) - FCC Challenge

100%

Caesars Cipher (ROT13) - FCC Challenge

✓ Published0🌍 Public

Last edited Aug 4, 2016

Created on Aug 4, 2016

This example demonstrates the ROT13 Caesar cipher, a letter-substitution cipher that shifts each alphabetic character by 13 positions. It shows the transformation of an encoded input string into its decoded plaintext output. The JavaScript function `rot13` processes the string by splitting it into an array, applying the cipher logic via `Array.map`, and rejoining the characters. The cipher uses `charCodeAt` and `String.fromCharCode` to handle character codes, preserving non-alphabetic characters while shifting letters in the ranges A–M and N–Z. The visible test case decodes "V PENPXRQ GUR PBQR" to reveal the original message.

AI-generated description

Similar vizzes

Loading thumbnail…

Caesar Cipher Visualization

This interactive visualization demonstrates the Caesar cipher encryption technique by allowing users to input text and a shift value, then animating the transformation of the alphabet. The code uses D3.js v7 to render SVG letter boxes that smoothly transition colors and characters over a one-second animation, highlighting which letters shift and which remain unchanged. User input is processed through a custom `caesarCipher` function, while the `d3.select` and `transition` APIs drive the visual feedback.

Ffay Alomar

70% match

Loading thumbnail…

tryAll

This example demonstrates a brute-force attack on a Caesar cipher, decrypting a short encrypted string by testing all 24 possible shift keys. It shows the decryption attempts in a visualization, highlighting how different keys produce varying results. The code uses Node.js file system operations (`fs.readFileSync`) to load a frequency list from an external text file, then applies the `isEnglish` module to score each attempt. The `caesar` module performs the shift-based decryption, while `tryAll` iterates through all keys.

PPeleke

60% match

Loading thumbnail…

Data Encryption Testing

This example demonstrates how AES encryption transforms a short plain-text message into a much longer ciphertext, highlighting the approximately 4× size increase. The page renders both the unencrypted string and its encrypted form in green terminal-style text on a black background. It uses the CryptoJS library’s `AES.encrypt` and `AES.decrypt` methods with a fixed secret key, then displays the results via `document.getElementById().textContent`. The visualization is purely textual, with no charts or data beyond the two message strings.

CCurran Kelleher

52% match

Loading thumbnail…

Gist 6ca203fa1eab16a0f3c98d442ba9eea0

This example demonstrates a JavaScript function that transforms an input string into a "mumbling" pattern, where each character is repeated incrementally, capitalized at the start, and joined by hyphens. The visualization shows the result of applying this logic to sample strings like "abcd," "cwAt," and "RqaEzty" using the built-in `split`, `toLowerCase`, `toUpperCase`, `slice`, `map`, and `join` methods, along with custom `capitalize` and `accum` functions. The code relies on plain JavaScript string array manipulation without external libraries, producing outputs such as "A-Bb-Ccc-Dddd" for the first example.

MMistyBlunch

51% match

Loading thumbnail…

Base64.js

This example demonstrates a compact implementation of Base64 encoding in JavaScript, showing how binary data can be converted into a six-bit character representation using the standard Base64 alphabet. The code defines a function, `encode`, that iterates over the input string’s character codes and constructs the output by bit-shifting values and selecting characters from a lookup string. It uses standard JavaScript string methods like `charCodeAt` and `charAt` alongside bitwise operators, with no external libraries or visualization components involved. The example serves as a clear, minimal demonstration of encoding logic rather than a data-driven graphic.

Mmbostock

49% match

Loading thumbnail…

fussing with UTF-16 surrogate encoding in Javascript

This example demonstrates how JavaScript encodes Unicode code points above U+FFFF into UTF-16 surrogate pairs, using functions like `escapeUTF16` and `makeSurrogate` to convert a code point such as U+1F339 (a rose emoji) into the escaped `\ud83c\udf39` sequence. The code implements the surrogate math from the Wikipedia UTF-16 specification, applying bitwise shifts and masking to derive lead and trail surrogates for supplementary planes. It then verifies the result by parsing the escaped string with `JSON.parse` and comparing it to the literal surrogate pair. The source is a standalone gist with no external libraries or data visualization dependencies.

RRandomEtc

48% match

Loading thumbnail…

Gist ffcc056cd10b4ea1386f2a81189aa95a

This example shows the reverse complement of a DNA sequence, converting each nucleotide to its complementary base and reversing the order. The code defines a hardcoded string of genetic letters and processes it character by character using a `for` loop and a `switch` statement. It outputs the transformed sequence to the console with `console.log`, producing a string like “GGCTAGCTACGCCGCGACTAGCTACATGCGCGCTCAGCATCATCGCCGCGCAGGTTTGC.” No external libraries are used; the entire visualization is a plain JavaScript computation and text output.

WWanagram

47% match

Loading thumbnail…

Refucktoring: Roman numerals in LUA

A deliberately obfuscated Lua implementation of Roman numeral conversion hides all arithmetic and constants behind absurdly named functions and Monte Carlo simulation. The code defines numerals like Cicero() for "C" and IIIII() for "V", then derives values by random sampling. It uses the Busted testing framework to validate conversion functions sourced from Rosetta Code.

Aabehmiel

47% match