{"version":"1.0","type":"rich","title":"Locating Restriction Sites Algorithm","description":"This visualization demonstrates the Locating Restriction Sites algorithm, which identifies reverse palindromes in a DNA string. It shows the positions and lengths of every reverse palindrome between 4 and 12 base pairs in the sample sequence TCAATGCATGCGGGTCTATATGCAT, with results displayed as coordinate pairs. The Python script uses BioPython’s `SeqIO.parse` to read the DNA sequence from a FASTA file, then applies nested loops to check each substring against its reverse complement. Output is formatted as text lines pairing position and length, printed to the console.","provider_name":"VizHub AI Studio","provider_url":"https://next.vizhub.com","html":"<iframe src=\"https://next.vizhub.com/viz/gist-21163bc1b21c9ae5847e3995c4fb8617?mode=embed\" width=\"960\" height=\"500\" scrolling=\"no\" frameborder=\"1\"></iframe>","width":960,"height":500,"cache_age":3600}